www com hd 44 Videos

Did you mean?

Search Results - Showing 0 - 12 Of 73

44 from www com hd 44
⏲ 12:52 👁 36.5M
Redline Powersports Sumter
⏲ 1 minute 4 seconds 👁 138
Carl's Mower u0026 Saw
⏲ 13 minutes 59 seconds 👁 14.5K
Billionaire investors of the internet era are now locked in a war of words and influenced to determine whether AI's future will be one of concentrated safety or unfettered advancement. The stakes couldn't be higher.<br/><br/>In May 2023, OpenAI CEO Sam Altman appeared on Capitol Hill for a Senate subcommittee meeting on AI. The substance of his message: Regulate us. For his opponents, this was the mask-­off moment they’d been wait­ing for. Three months earlier, Musk, who had cofounded and bankrolled OpenAI when it was still an open­ source nonprofit, had taken to X to decry OpenAI’s recent multibillion­ dollar capi­tal infusion from Microsoft. From its nonprofit roots, OpenAI had evolved into a “closed­ source, maximum­ profit company effectively controlled by Microsoft,” Musk said.<br/><br/>For Vinod Khosla and Reid Hoffman—who met with Alt­man together at least once to talk strategy but otherwise move in separate circles—OpenAI’s willingness to compromise is how to get things done. Whether Hoffman is talking to Biden, Pope Francis or U.S. Commerce Secretary Gina Raimondo, a frequent collaborator in recent months, their questions are similar: How will constituents’ lives change because of AI? What about their jobs? When should they be excited for benefits, or cautious about risks? “You have to show you understand what their primary game is, and that they can trust you to figure it out,” Hoffman says. “If your approach to government is to say ‘get out of my way,’ then you’re not help­ing with their game.”<br/><br/>Read the full story on Forbes: https://www.forbes.com/sites/alexkonrad/2024/06/04/inside-silicon-valley-influence-battle-for-ai-future/?sh=44d2570c2dc4<br/><br/>0:00 Introduction<br/>0:59 Where Is Silicon Valley On AI<br/>5:03 Reid Hoffman And The State Of Open AI<br/>7:44 Where Does Social Media And AI Regulation Stand?<br/>9:55 Vinod Khosla's Take On Open AI And The State Of The Industry<br/>13:30 Will Regulations Aid Our Society From AI Going To Far?<br/><br/>Subscribe to FORBES: https://www.youtube.com/user/Forbes?sub_confirmation=1<br/><br/>Fuel your success with Forbes. Gain unlimited access to premium journalism, including breaking news, groundbreaking in-depth reported stories, daily digests and more. Plus, members get a front-row seat at members-only events with leading thinkers and doers, access to premium video that can help you get ahead, an ad-light experience, early access to select products including NFT drops and more:<br/><br/>https://account.forbes.com/membership/?utm_source=youtube&utm_medium=display&utm_campaign=growth_non-sub_paid_subscribe_ytdescript<br/><br/>Stay Connected<br/>Forbes newsletters: https://newsletters.editorial.forbes.com<br/>Forbes on Facebook: http://fb.com/forbes<br/>Forbes Video on Twitter: http://www.twitter.com/forbes<br/>Forbes Video on Instagram: http://instagram.com/forbes<br/>More From Forbes:http://forbes.com<br/><br/>Forbes covers the intersection of entrepreneurship, wealth, technology, business and lifestyle with a focus on people and success.
⏲ 15:51 👁 2.3M
Andrew McAlpine
⏲ 51 seconds 👁 341
67dno
⏲ 13 minutes 32 seconds 👁 5.3K
Just 11% of Americans would give themselves an A+ for their sustainability efforts, according to new research.<br/><br/>A survey of 2,000 adults looked at their sustainability habits, especially when it comes to the kitchen, and found that nearly one in four would grade themselves a C or lower (23%).<br/><br/>Although 77% claim to make efforts to be as wasteless as possible, respondents average throwing away 12 items in a given day.<br/><br/>This adds up, as the average American disposes of nearly three bags of trash a week — totaling over 150 bags of trash in a year.<br/><br/>Despite being the likeliest to give themselves an A+ (15%), millennials average the most trash in a day, throwing about 15 things away.<br/><br/>Conducted by Talker Research for The Chinet Brand, the survey found that the room in the home that sees the most waste is the kitchen (80%) — four times more than the second most-chosen room, the bathroom (20%).<br/><br/>On average, respondents cook seven times a week, with 48% having the goal of making meals they won’t waste and another 37% wanting to make sure that the meals they make have little waste when cooking.<br/><br/>Forty-one percent said food waste is “always” or “often” on their mind when cooking, with millennials claiming to think about it the most (44%).<br/><br/>Although a majority surveyed said it’s a high priority to utilize food before it goes bad (82%), Americans estimate that about a fifth of the food they make gets thrown away (18%).<br/><br/>To reduce food waste, respondents have frozen leftovers (55%) or ingredients (54%) and repurposed their leftovers (50%) or food scraps to make new foods (32%).<br/><br/>More than a quarter of Americans shared that they use “sustainability hacks” in the kitchen (27%) like making “veggie stock out of vegetable scraps,” “storing food in mason jars” or making sure “items in refrigerator and freezer are arranged that are next expiring.”<br/><br/>“Small shifts in preparation and cooking habits can lead to big strides when it comes to reducing waste,” said Melissa Rakos, Chinet brand manager. “Additionally, purchasing compostable products, or items with recyclable or compostable packaging, can make it easy to reduce the amount of waste we contribute to landfills.”<br/><br/>Overall, two-thirds of respondents think they can do a better job of reducing the amount of waste they dispose of, especially those from Gen Z (73%).<br/><br/>Education may be key to making changes Americans feel better about since 40% revealed they feel unknowledgeable about composting food scraps, but Gen Zers are most keen on learning how to (70%).<br/><br/>Nearly seven in 10 also feel at least a little guilty when using disposable items (69%) like plastic bags (29%), disposable water bottles (28%) and plastic or paper plates (22%).<br/><br/>Respondents feel better about using disposable plates and cups if they know they’re made from recycled materials or are recyclable (68%).<br/><br/>And while 28% always recycle items in their home that can be recycled, 62% admitted to throwing something away because it’s inconvenient to recycle at least sometimes.<br/><br/>For many, self-reflection will also help in sustainability efforts as one in six realized they were more wasteful than they originally thought at the start of the survey.<br/><br/>“Changing small, daily habits can add up over time,” Rakos said. “Something as simple as using more sustainable disposable products can help make those shifts a little easier.”<br/><br/>KITCHEN SUSTAINABILITY HACKS<br/>● “Freezing certain foods to keep them fresh longer”<br/>● “Plan out several different meals using some of the same ingredients”<br/>● “Storing food in mason jars”<br/>● “Buying in bulk and breaking them down into individual packaging to prevent the amount overcooked for a meal”<br/>● “I use only fresh ingredients and take any byproducts or leftovers and return them to the forest”<br/>● “Items in refrigerator and freezer are arranged that are next expiring”<br/>● “Wrap celery in foil to make it last longer”<br/>● “Growing new plants from the \
⏲ 0:58 👁 2.1M
SUEÑOS DE TELENOVELA
⏲ 41 minutes 53 seconds 👁 31.2K
MB MOWING
⏲ 2 minutes 2 seconds 👁 447
Eva Mendes put Hollywood on hold a decade ago to raise a family with Ryan Gosling. Now the 50-year-old actress is reemerging as a cleaning-supplies entrepreneur, and dishes on why doing dishes is her happy place. <br/><br/>To get to this blissful place in her life—where she spends most evenings finding happiness over the kitchen sink in her Southern California home, where she lives with 43-year-old actor Ryan Gosling and their two daughters—took years of hard work, a gene she says she got from her Cuban immigrant mother. From the time Mendes was a little girl, her mom would explain that freedom is when you make your own money.<br/><br/>Since performing in her last movie, 2014’s “Lost River,” Mendes has become a mother, fashion designer, children’s book author and the co-owner of a successful home cleaning goods startup, Skura Style. After taking an ownership stake in 2022, Mendes has helped Skura—which was founded in 2017 by Linda Sawyer and Alison Matz—expand its marketing reach and has even dabbled in product design. Forbes estimates the business brought in $7 million in revenue last year and is on track for $20 million in 2024.<br/><br/>Read the full story on Forbes:<br/>https://www.forbes.com/lifestyle/<br/><br/>0:00 Introduction<br/>0:31 “Freedom is Making Your Own Money”<br/>1:59 Becoming an Actress<br/>3:13 Hollywood: Expectation vs. Reality<br/>5:14 Business Isn’t Personal<br/>6:10 Working With Ryan Gosling<br/>6:41 Eva’s Most Challenging Role<br/>8:10 Taking a Break from Hollywood<br/>10:08 Motherhood is Creativity<br/>11:19 Joining Skura Style<br/>14:01 The Female Founder Space<br/>15:44 What Makes Skura Style Special<br/>18:20 Eva’s Newest Role: Co-Owner<br/>19:26 Eva Mendes X Skura Style Collection<br/>22:00 What’s Next for Skura Style<br/>23:20 Eva’s Legacy<br/><br/>Subscribe to FORBES: https://www.youtube.com/user/Forbes?sub_confirmation=1<br/><br/>Fuel your success with Forbes. Gain unlimited access to premium journalism, including breaking news, groundbreaking in-depth reported stories, daily digests and more. Plus, members get a front-row seat at members-only events with leading thinkers and doers, access to premium video that can help you get ahead, an ad-light experience, early access to select products including NFT drops and more:<br/><br/>https://account.forbes.com/membership/?utm_source=youtube&utm_medium=display&utm_campaign=growth_non-sub_paid_subscribe_ytdescript<br/><br/>Stay Connected<br/>Forbes newsletters: https://newsletters.editorial.forbes.com<br/>Forbes on Facebook: http://fb.com/forbes<br/>Forbes Video on Twitter: http://www.twitter.com/forbes<br/>Forbes Video on Instagram: http://instagram.com/forbes<br/>More From Forbes:http://forbes.com<br/><br/>Forbes covers the intersection of entrepreneurship, wealth, technology, business and lifestyle with a focus on people and success.
⏲ 24:7 👁 5.6M
MB MOWING
⏲ 3 minutes 28 seconds 👁 1.3K
Comunidade Profética Vinicius Iracet
⏲ 14 minutes 26 seconds 👁 322
Pages 1 Of 7
... ...
Next »

Related Searches

Search Videos

Recent Searches

all java games di | ishq ki dastaan 230 | ggggccactagggacaggat | tui dubai ki amar chat pari rajkonna ra koli mp song mp3 | x7yhij0 | jyn7dpbepwi | chal wahan jaate video | কাঠুন ঠুকুমা জুল¦ | girl tight | whapshare | xwwwkoreantvv | faceit csgo client | bade maya japan james laptop | peris | housefull 4 full movie hd torrent download | indian cu | পিলিম ভিডিওর ছবিেশ নায়িকাদের ছবি | ruma মেয়েদের ছবিচি | indian summary | বাংলাদেশি হোটেল পতিতা গাল | tmr barir ronger malai dejhe silam baiyoskop | bull fm video | illiteral meaning | www হিন্দু মেয়ে দের ছবি কলেজের মেয়েদের চো www োয¦ | yhda mp | zombies official | pastor song bia de pa sultan amer ma prio jononi google | indian bangla nova | sandamtod walk around | meena images | মোটা মেয়েদের ওসোন | sayantika fake full photo | denki reader tiktok | jamai 420 movis song | piya more fusionbd com | bangla kadir mouvi song | grandpas last jelly | tunga nzola | warfaze band song joto dur | ফিরে তো | rain in argentina | september skyline | parbona ami chart toke song mum amar | vdm23274785 | dapper stack exchange | don2 mp3 | bangladeshi badr | jeno tomari kasea mp3 song | bangla rs xw rajwap com | বা‚লা ভিডি“দেশের অপুর পিকচারসর shudhu tor jonno | valobasha lemon chowdhury | vip php | bangla nxn com াসর রাতের হট হট ছবি | chootto ekta prithibi amar chotto ghor by hridoy kh | سکسی های هارلی کویین | naika rukma photos | video বাংলাদেশি video | মেয়েদের মাসিকের সময় কি ভাবে কাপড় পড়ে তার রক্ত পাড়ার ছবিিয়া মাহি full photo little girl original photo n | vdm143692229 | jamai 420 hd video hd ভাই ছোট বোনের সাথে | kano ken mon pagla si tutul fast code videos gp inc | ekim | fear files 07 2012 | bangla movie moner maje p video | আচল নাটকের টুশু musicjan মেয়েদের চুদাচুদ | vdm144344250 | waptrick vom | all indian bow ant | hotstar bojh | سکس خونه خالی مامان امیر ایرانی | new video 20 www com | bangla new bran | coppins house |